rs6103006 chr20:36958168 T>A
- Sequence
aacaatggggccaaagagctctca[T/A]gtcccatccttagggctccacatc
- ASB in cell types
- macrophages form periferal blood CD14+ monocytes MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.47 | 0.41 | 1.77 | n/a | No Hit | |||
| STAT1_HUMAN | 3.27 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2