rs6103555 chr20:44001826 T>C
- Sequence
gagctgtggtttgaaactagagcc[T/C]gggacattcccccatttcccgtgc
- ASB in cell types
- Th1-cells GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Th1-cells | 2.06 | n/a | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.71 | 1.16 |
Items per page:
1 – 2 of 2