rs6103716 chr20:44370990 A>C
- Sequence
gaaggagcaggtcagaaagttgtc[A/C]aaacaggcatgacgaagggcagag
- ASB in cell types
- MDA-MB-134 (invasive lobular breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-134 (invasive lobular breast carcinoma) | -1.21 | 2.23 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic root diameter, aortic valve calcium, body mass index (bmi), diastolic blood pressure (dbp), fasting insulin, homa-ir, serum creatinine, type 2 diabetes