rs6104589 chr20:1108480 T>C
- Sequence
ggtatttccaggtgtgaaggctga[T/C]tgcagtgtggacagagcctgctgg
- ASB in cell types
- MCF10CA1a (breast metastatic epithelial cells) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10CA1a (breast metastatic epithelial cells) | 2.94 | -5.27 | 2.00 | |||
| neural cell | -0.03 | 1.80 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial