rs6105631 chr20:16574975 G>C
- Sequence
agcggcgggttggtttgagaagcc[G/C]ccagggagccagcgcggcgaccta
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes 22RV1 (prostate carcinoma)
- ASB for transcription factors
- TYY1_HUMAN RBM25_HUMAN STAT1_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 2.50 | -0.61 | 1.25 | n/a | No Hit | |||
| RBM25_HUMAN | 1.01 | -0.44 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.12 | n/a | 2.33 | n/a | No Hit | |||
| MEF2B_HUMAN | -3.23 | 2.10 | 1.50 | n/a | No Hit | |||
| ELF1_HUMAN | 2.41 | -2.11 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood