rs6107589 chr20:5169405 T>C
- Sequence
ctgcaggggcaccagtcaggcaca[T/C]gagcaggaaagtgggtactatcat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.02 | 1.01 | 1.16 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hip bone mineral density (bmd), plasma aldosterone concentration, spine bone mineral density (bmd), urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood