rs6107835 chr20:728488 T>G
- Sequence
ggctgcggagcgcggcgccgagac[T/G]cagaggagggggcgctggggaagc
- ASB in cell types
- foreskin keratinocyte HepG2 (hepatoblastoma) GSC23 (Glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.93 | n/a | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.40 | 0.83 | 1.12 | |||
| GSC23 (Glioblastoma) | n/a | 1.83 | 3.00 |
Items per page:
1 – 3 of 3