rs6108658 chr20:10660312 C>T
- Sequence
cctgacaccccggcacgcactgaa[C/T]cacttgcaggcaggtaacacttta
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | n/a | 3.43 | 1.50 | n/a | No Hit | |||
| ZFHX2_HUMAN | -2.45 | 2.39 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), height, obesity with early age of onset (age >2), type 2 diabetes