rs6108787 chr20:10986566 T>G
- Sequence
gggaaagcagaactcaggccctgg[T/G]gaagccatgcggccaatcatccca
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.04 | -1.84 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI diastolic blood pressure, diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test), diastolic blood pressure x alcohol consumption interaction (2df test), mean arterial pressure x alcohol consumption (light vs heavy) interaction (2df test), mean arterial pressure x alcohol consumption interaction (2df test), medication use (beta blocking agents), medication use (diuretics), systolic blood pressure, systolic blood pressure x alcohol consumption interaction (2df test)