rs6108909 chr20:11305669 T>C
- Sequence
tgagctgaatagaaaggatattat[T/C]ggctcaagcttcctctgggtggtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.03 | 0.95 | 1.15 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, alzheimers disease, homa-ir, maternal transmission distortion, transmission distortion, triglycerides change with statins