rs6111647 chr20:17748366 C>G
- Sequence
ctagcagttgctcccctcccccag[C/G]ccaacccagcccctggcgatcaca
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZNF7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF7_HUMAN | -3.06 | 3.12 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1