rs6111901 chr20:18280202 A>G
- Sequence
taacgcaatgctcagacttcctca[A/G]ttatgaatatggtaaaaaaaatta
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.51 | -0.01 | 1.80 | -0.93 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, alzheimers disease, cystatin c in serum, type 2 diabetes
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood