rs6116210 chr20:4114455 G>A
- Sequence
acagatggtgtcactcaacaggac[G/A]gtgggataaactgtcagctccagc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) monocyte-derived dendritic cells CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 2.67 | 1.00 | |||
| monocyte-derived dendritic cells | -0.14 | 2.98 | 1.50 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.49 | -0.11 | 1.50 |
Items per page:
1 – 3 of 3