rs6116934 chr20:5751157 T>C
- Sequence
tacattcaccacgtccactccgcc[T/C]caagtcctagacaattgctagtat
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | n/a | 2.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alzheimers disease, amyotrophic lateral sclerosis (als), hdl cholesterol, rheumatoid arthritis, sporadic creutzfeldt-jakob disease
GTEx eQTL Brain_Cortex, Breast_Mammary_Tissue, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood