rs6117065 chr20:6074391 G>A
- Sequence
tagaggaagccatttctaccctct[G/A]tgggctgacaggagaattgcacaa
- ASB in cell types
- Peyer's patch pancreas GM02255 (Lymphoblastoid Cell Lines) esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.11 | 2.05 | 1.48 | -0.75 | Weak Discordant | |||
| STAG1_HUMAN | -1.55 | 2.26 | 2.05 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP maternal transmission distortion, pulse rate, salmonella-induced pyroptosis, schizophrenia, tetrology of fallot, transmission distortion
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Esophagus_Mucosa, Minor_Salivary_Gland, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid