rs6117164 chr20:695798 T>G
- Sequence
gtagacaggaaatgagcttttaat[T/G]tggatttctctaattactcagagg
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.39 | -4.00 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, lp-pla2 activity, triglycerides change with statins