rs6122141 chr20:62642365 G>C
- Sequence
cgcgttcccgcctctgtgccctgg[G/C]ggggaggagggggcggtcgccgct
- ASB in cell types
- HEK293 (embryonic kidney) neural cell spleen upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.03 | 1.20 | 1.63 | 0.95 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg