rs6123325 chr20:53916057 C>T
- Sequence
ggcatgattcagggcaaagggcgc[C/T]catcagagctgctttaggcaaagg
- ASB in cell types
- K562 (myelogenous leukemia) neutrophils from periferal blood HEK293 (embryonic kidney) germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 2.70 | -0.12 | 2.00 | n/a | n/a | |||
| TEAD3_HUMAN | -1.91 | 2.40 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2