rs6124203 chr20:40017965 T>C
- Sequence
gaatatatttgtgcatttgggtta[T/C]gcaatagtttcttagatataacac
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | n/a | 2.16 | 5.00 | -2.22 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
