rs6127774 chr20:56504566 G>A
- Sequence
ggctgagccttctctgtgctctgt[G/A]tcgcccccaagggtgagtctgcgc
- ASB in cell types
- Jurkat (T-cells) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | 1.68 | -0.14 | 1.12 | |||
| erythroid progenitors | n/a | 2.39 | 2.50 |
Items per page:
1 – 2 of 2