rs6128156 chr20:57773534 T>G
- Sequence
ttcaaatgtcacatgacattagat[T/G]ttccccccaaccatttagctatgt
- ASB in cell types
- breast tumor
- ASB for transcription factors
- SUMO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SUMO2_HUMAN | -0.17 | 1.58 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol, parkinsons disease