rs6129532 chr20:40255548 G>T
- Sequence
tggacattttcccagacattcagg[G/T]ttttcaacatgtggccaccaggcg
- ASB in cell types
- epithelial cell of prostate upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.23 | 1.26 | 1.32 | n/a | No Hit | |||
| GRHL2_HUMAN | -0.43 | 1.88 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, bone disease severity in n370s homozygous gaucher disease, height, hypertension (early onset hypertension), ldl cholesterol, microalbuminuria, total cholesterol, triglycerides