rs6129548 chr20:40266369 C>A
- Sequence
gaaaaacctccaggcatggatgtc[C/A]tatgtgcaccattccatcagaaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) neural cell MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.01 | 0.98 | 1.53 | |||
| neural cell | -0.46 | 1.40 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.39 | 1.38 | 1.50 |
Items per page:
1 – 3 of 3