rs6129589 chr20:40397149 A>C
- Sequence
aaatgaggaagtgcaattccaaaa[A/C]ctcctagatatcatatcttcccat
- ASB in cell types
- THP-1 (acute monocytic leukemia) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.59 | 1.59 | 1.60 | |||
| macrophages form periferal blood | 1.87 | -0.55 | 2.00 |
Items per page:
1 – 2 of 2