rs6129700 chr20:40892941 A>G
- Sequence
tgatgacctgtacagagcatcagc[A/G]ttgctacagtcaaacagcctgagg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) MCF7 (Invasive ductal breast carcinoma) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.88 | 0.36 | 1.07 | n/a | n/a |
Items per page:
1 – 1 of 1