rs6130412 chr20:43537082 G>A
- Sequence
cacttgcccaaggtcattcacctt[G/A]taagggggagagctggcattccaa
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-BR-3 (breast adenocarcinoma) | -0.39 | 1.74 | 2.00 |
Items per page:
1 – 1 of 1