rs6132654 chr20:23723828 T>C
- Sequence
agtttgcagagaacctctgtaagg[T/C]ggggcctgcatcctccacttcaca
- ASB in cell types
- WA09 (embryonic stem cells) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.63 | -0.23 | 1.50 | |||
| epithelial cell of prostate | 2.20 | n/a | 3.00 |
Items per page:
1 – 2 of 2