rs6133248 chr20:5674427 T>C
- Sequence
tagaaagacctatatgtggtgaca[T/C]ggcaagatagagcaacatagctca
- ASB in cell types
- monocyte-derived macrophages from peripheral blood GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia) germinal center B-cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.94 | 1.54 | 1.63 | n/a | No Hit |
Items per page:
1 – 1 of 1