rs6134969 chr20:13777296 G>A
- Sequence
ttgacacggggactgggagttttg[G/A]aagtgtcaaagatgagtcatagct
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | -0.95 | 1.65 | 1.20 | |||
| monocyte-derived dendritic cells | -0.65 | 1.46 | 1.67 |
Items per page:
1 – 2 of 2