rs6135478 chr20:15666336 A>C
- Sequence
attaagttatctcttccatcttct[A/C]ttcaatgtgatccaatcttccccc
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 2.20 | 0.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), ldl cholesterol change with statins, mitral annular calcium, parkinsons disease (pd), rheumatoid arthritis, schizophrenia, total cholesterol change with statins, triglycerides, triglycerides change with statins