rs6137726 chr20:22691782 C>A
- Sequence
cccttttgaagcagccgcttaggc[C/A]gtctgcaattaagccgatttgaca
- ASB in cell types
- neutrophils from periferal blood GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 3.12 | 0.28 | 1.50 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.94 | 0.99 | 1.00 |
Items per page:
1 – 2 of 2