rs6138081 chr20:23782714 G>A
- Sequence
taaactaagcattccctgagtgcc[G/A]tacgggttctgcagaggcccgtct
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.60 | 0.48 | 1.56 | n/a | No Hit | |||
| STAG1_HUMAN | 1.53 | -0.47 | 1.24 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach