rs6138281 chr20:2508885 G>A
- Sequence
gccgcggaggccgcgctcaccaga[G/A]ccagcgtgcccgggatctcggcca
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor T47D (invasive ductal carcinoma) brain prefrontal cortex region tissues
- ASB for transcription factors
- OLIG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OLIG2_HUMAN | n/a | 2.49 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood