rs6138457 chr20:24992870 T>G
- Sequence
ccccggcgcgtcgttgctcggcgc[T/G]ctgaggctaattctgaccgcccgg
- ASB in cell types
- HCC1806(Squamous cell breast carcinoma, acantholytic variant) primary B-CLL cells HepG2 (hepatoblastoma)
- ASB for transcription factors
- MNT_HUMAN ZFX_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -2.98 | 2.04 | 1.50 | n/a | n/a | |||
| ZFX_HUMAN | 0.31 | 1.51 | 1.38 | n/a | No Hit | |||
| TYY1_HUMAN | 0.71 | 1.26 | 1.20 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood