rs6138678 chr20:2652650 G>C
- Sequence
agccgcattgcgagccgaacccgg[G/C]agctggcgccatggtgaggagtgg
- ASB in cell types
- HepG2 (hepatoblastoma) MOLT-4 (Adult T acute lymphoblastic leukemia) EA.hy 926 (human umbilical vein endothelial cell line) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- TYY1_HUMAN HIF1A_HUMAN RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.38 | 1.50 | 1.88 | n/a | No Hit | |||
| HIF1A_HUMAN | 2.81 | -5.04 | 2.00 | n/a | No Hit | |||
| RBM25_HUMAN | 1.54 | -0.25 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood