rs6138735 chr20:2664553 C>G
- Sequence
cgtttgttattcttttaaccagta[C/G]tcactgaatacctgtatgtcaggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 1.10 | 1.10 | |||
| HepG2 (hepatoblastoma) | -2.13 | 2.48 | 1.50 |
Items per page:
1 – 2 of 2