rs6138879 chr20:2743317 T>A
- Sequence
gcggcacccggagggtcggcagtc[T/A]ctctaggtccaggggagagcccgg
- ASB in cell types
- glioblastoma cells foreskin keratinocyte GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -0.73 | 2.63 | 1.50 | |||
| foreskin keratinocyte | 0.81 | n/a | 2.33 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.91 | -0.40 | 1.00 |
Items per page:
1 – 3 of 3