rs6139711 chr20:5399991 A>T
- Sequence
gtgtgtgattttcttgtgcatcca[A/T]ctagattgtaagctccacgaggat
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CRC107 (colorectal cancer metastatic stem cells) | 0.94 | -0.47 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), hdl cholesterol change with statins