rs6140518 chr20:8067071 T>G
- Sequence
aatcaagatatgaaaaaaacaatt[T/G]taaaacattagtaattcttatgca
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.13 | -4.25 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Thyroid