rs6141378 chr20:33262842 G>A
- Sequence
tgttgcacatatatgtacttccca[G/A]ctaccaccctgggaatgaacacta
- ASB in cell types
- glioblastoma cells GM10847 (female B-cells Lymphoblastoid Cell Lines) esophagus squamous epithelium H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.45 | -0.30 | 2.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.73 | -1.59 | 1.00 | |||
| esophagus squamous epithelium | 1.67 | -1.20 | 1.00 | |||
| H929 (plasma cell myeloma) | 1.47 | n/a | 2.00 | |||
| adrenal gland | 0.87 | -0.40 | 1.00 |
Items per page:
1 – 5 of 5