rs61419047 chr8:74984576 C>A
- Sequence
gagcaagaggtcgccgccagcctc[C/A]gccgccgagcctcgttcgtgtccc
- ASB in cell types
- glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.96 | -3.36 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Stomach, Testis