rs6142641 chr20:62369202 G>A
- Sequence
tgcttcccggcagacagctgcccc[G/A]ggagcaactggcaggcaggcgggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.10 | 0.70 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.15 | 0.85 | 2.05 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Thyroid