rs61499898 chr16:49440540 C>T
- Sequence
tgtttgttgcagggcaggaggggc[C/T]tgtcctctgggctacagggtgttt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 2.44 | 0.12 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.77 | -1.50 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.37 | n/a | 3.00 |
Items per page:
1 – 3 of 3