rs61745466 chr11:74949038 T>G
- Sequence
gatctcggagccgctccactgcgg[T/G]gcctgccgctatcttccccacgcc
- ASB in cell types
- monocytes from periferal blood GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.53 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1