rs61776594 chr1:26126903 G>A
- Sequence
gtaatcccagcactctgggaggcc[G/A]aggtaggtggatcacctgaggtca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- C2D1A_HUMAN SPT5H_HUMAN ENL_HUMAN ZN740_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| C2D1A_HUMAN | 2.76 | -2.50 | 1.00 | n/a | n/a | |||
| SPT5H_HUMAN | 1.71 | -1.51 | 1.00 | n/a | n/a | |||
| ENL_HUMAN | 1.41 | -2.27 | 1.50 | n/a | n/a | |||
| ZN740_HUMAN | -2.24 | 2.60 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid