rs61783057 chr1:85461043 G>A
- Sequence
gcaggaggattgttgagcccagaa[G/A]ttcaaggctgcagtgagctatgat
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SMAD4_HUMAN BCL6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD4_HUMAN | 2.85 | -4.85 | 1.50 | n/a | No Hit | |||
| BCL6_HUMAN | 2.25 | -1.90 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood