rs61829760 chr1:210374013 C>G
- Sequence
acttttatcatgcaagtattcaga[C/G]ctttgacatggaaaacaagagtta
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) A549 (lung carcinoma) breast tumor TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- FOXA1_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.57 | 0.38 | 2.14 | n/a | No Hit | |||
| JUN_HUMAN | 0.44 | 0.95 | 1.95 | n/a | No Hit |
Items per page:
1 – 2 of 2