rs61846889 chr10:49762383 G>A
- Sequence
gggcgcgcgcccctgagactccgc[G/A]cgtcgtgacgtctccatggatgcc
- ASB in cell types
- T47D (invasive ductal carcinoma) HepG2 (hepatoblastoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- HIF3A_HUMAN RBM25_HUMAN REST_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF3A_HUMAN | n/a | 3.10 | 1.50 | n/a | n/a | |||
| RBM25_HUMAN | n/a | 3.14 | 1.00 | n/a | n/a | |||
| REST_HUMAN | 0.42 | 1.41 | 1.44 | n/a | No Hit | |||
| HIF1A_HUMAN | -3.44 | 2.23 | 1.25 | 8.20 | Concordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood