rs61867607 chr11:1388083 T>C
- Sequence
gcagcctgggaggccaggtgacca[T/C]ggcagcagagagagggcatctcag
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.33 | -0.12 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Pituitary, Skin_Sun_Exposed_Lower_leg, Whole_Blood