rs618964 chr12:3275733 G>C
- Sequence
tgcccattctttgggagccctgac[G/C]tggttccatgtggggctgcgccag
- ASB in cell types
- upper lobe of left lung MCF7L-P(immortalized breast epithelial cell line) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 0.91 | -0.30 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.36 | 1.42 | 2.00 | |||
| IPSC-derived bipolar neuron | 1.62 | 0.02 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Thyroid